View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12734_high_5 (Length: 302)
Name: NF12734_high_5
Description: NF12734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12734_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 7 - 281
Target Start/End: Original strand, 44465445 - 44465719
Alignment:
| Q |
7 |
gacgttggagatatttgttgattaggtctgagaattttcgggattgtgatagtgattttttgactgagaatcgaccataatcataaacgttagcgttttg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44465445 |
gacgttggagatatttgttgattaggtctgagaattttcgggattgtgatagtgattttttgactgagaatcgaccataatcataaacgttagcgttttg |
44465544 |
T |
 |
| Q |
107 |
aggtgggagaatggatttgcaataggttgggtcaggggtggatttgcatgctgctcctggtgaaataggtgtaattggatttggattattaacggtgttt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44465545 |
aggtgggagaatggatttgcaataggttgggtcaggggtggatttgcatgctgctcctggtgaaataggtgtaattggatttggattattaacggtgttt |
44465644 |
T |
 |
| Q |
207 |
tgtgaaaatgctatagagacagataaaagaatgagaaatattgagaggggattacatagcttggaagccatattg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44465645 |
tgtgaaaatgctatagagacagataaaagaatgagaaatattgagaggggattacatagcttggaagccatattg |
44465719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University