View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12735_low_15 (Length: 318)
Name: NF12735_low_15
Description: NF12735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12735_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-138; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 18 - 301
Target Start/End: Original strand, 53425520 - 53425803
Alignment:
| Q |
18 |
aacaaattcatggcagcttttattctaatggacctcataagcgtaaacatagaaataatgtataggatataacaggttggcttgactcgatttatgtgag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
53425520 |
aacaaattcatggcagcttttattctaatggacctcataagcgtaaacatagaaataatgtatgggatataacaggttggcttgactcgatttatgtgag |
53425619 |
T |
 |
| Q |
118 |
agagaaattcaaatcaatcacatattgattagcagggtttggttaaatttatgtaatattttgttacaaaatcataatcaattcagatcgatgaaaaaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53425620 |
agagaaattcaaatcaatcacatattgattagcagggtttggttaaatttatttaatattttgttacaaaatcataatcaattcagatcgatgaaaaaca |
53425719 |
T |
 |
| Q |
218 |
tcttattcacaacacacctgttacagttggatgaattgaaatcttttgaggccatgcatgtgcctttccaaccgggtggaatag |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||||| | |||||| |||||||||||| ||||||||||| |
|
|
| T |
53425720 |
tcttattcacaacacacctgttacagttggatgagttgaagtcttttgatgtcatgcagatgcctttccaactgggtggaatag |
53425803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 233 - 301
Target Start/End: Original strand, 53434025 - 53434093
Alignment:
| Q |
233 |
acctgttacagttggatgaattgaaatcttttgaggccatgcatgtgcctttccaaccgggtggaatag |
301 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53434025 |
acctgttacagttggatgagttgaaatcttttgaggccatgcatgtgcctttccaaccgggtggaatag |
53434093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 233 - 300
Target Start/End: Original strand, 26098735 - 26098802
Alignment:
| Q |
233 |
acctgttacagttggatgaattgaaatcttttgaggccatgcatgtgcctttccaaccgggtggaata |
300 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| | |||||| || || |||||||||| ||||||| |
|
|
| T |
26098735 |
acctgttacagttggatgagttgaaatcttttgatgtcatgcaggtaccattccaaccggttggaata |
26098802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University