View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12735_low_18 (Length: 268)
Name: NF12735_low_18
Description: NF12735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12735_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 96 - 231
Target Start/End: Complemental strand, 5018780 - 5018646
Alignment:
| Q |
96 |
aaaattggtaaccctgtcaagttgacagtgtattaaactatcattatggaagaatttttgatgagctgcatctaatacatacctttagaatgaaatgata |
195 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5018780 |
aaaattggtaacccggtcaagttgagagtgtattaaactatcattatggaagaatttttgatgagctgcatctaatacatacctttagaatgaaatgata |
5018681 |
T |
|
| Q |
196 |
tttctttattttccacattttgtacgataacttttt |
231 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5018680 |
tttcttta-tttccacattttgtacgataacttttt |
5018646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University