View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12737_high_17 (Length: 238)
Name: NF12737_high_17
Description: NF12737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12737_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 173
Target Start/End: Complemental strand, 40649222 - 40649050
Alignment:
| Q |
1 |
aaaaataatcactaactcattagttaagaaaacaaatattgtaccaaaactcttccatttgtccataaacagtagaagctctgtctgatgctctatttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
40649222 |
aaaaataatcactaactcattagttaagaaaacaaatattgtaccaaaactcttccatttgtccataaacagtaaaagctatgtctgatgctctatttaa |
40649123 |
T |
 |
| Q |
101 |
aattgatttcaattcctaaatttctacaagtatgtagtaagaattttctccattgcacaaaagaaatctagaa |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40649122 |
aattgatttcaattcctaaatttctacaagtatgtagtaagaattttctccattgcacaaaagaaatctagaa |
40649050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University