View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12737_high_19 (Length: 228)
Name: NF12737_high_19
Description: NF12737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12737_high_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 14 - 214
Target Start/End: Complemental strand, 40543888 - 40543689
Alignment:
| Q |
14 |
cagagacacaacaacacaagtagaacatgaaaaacaaggaaacatcataagaaacatagttaacctaatttgaaacattcacccttgagggctcaaatct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40543888 |
cagagacacaacaacacaagtagaacatgaaaaacaaggaaacatcataagaaacatagttaaccaaatttgaaacattcacccttgagggctcaaatct |
40543789 |
T |
|
| Q |
114 |
gtcgacaatccatggtggctttggtggagctctctttgcgaaaacatttgctggtggaggagggatcatgacattgagggaggagggcggtggatctggt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40543788 |
gtcgacaatccatggtggctttggtggaactctctttgcgaaaacatttgctggtggaggagggatcatgaca-tgagggaggagggcggtggatctggt |
40543690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University