View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12737_high_20 (Length: 210)
Name: NF12737_high_20
Description: NF12737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12737_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 10 - 201
Target Start/End: Original strand, 10114784 - 10114971
Alignment:
| Q |
10 |
agaagaagaaaagtgagtgacggcacgtgagtgagtgtgatagtatattgggagtgatcgagtgtggtgagctgttacgtgtcgacatggatgacacgtg |
109 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10114784 |
agaagaagaaaagtgagttacggcacgtga----gtgtgatagtatattaggagtgatcgagtgtggtgagctgttacgtgtcgacatggatgacacgtg |
10114879 |
T |
 |
| Q |
110 |
gctgtttgtgattaattgaagttgttgtttggatttgggatctaaattcaatgctagtaacgtggtttggttgattgattgattcagtgaac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10114880 |
gctgtttgtgattaattgaagttgttgtttggatttgggatctaaattcaatgctagtaacgtggtttggttgattgattgattcagtgaac |
10114971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University