View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12737_low_34 (Length: 249)
Name: NF12737_low_34
Description: NF12737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12737_low_34 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 249
Target Start/End: Complemental strand, 11856285 - 11856042
Alignment:
| Q |
4 |
ggagaagcagagattaccaagattatatgcaggctaaggttctgtttagcactgatttatttccttttcaatctacattcgtcattattattgtcccttg |
103 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11856285 |
ggagaagcacagattaccaagattatatgcaggctaaggttctgtttagcactgatttatttccttttcaatctacatttgtcattattattgtcccttg |
11856186 |
T |
|
| Q |
104 |
tgtctatctggccgactttgtacatgactagcggatgttgtagcttgaaacaagcttgcttaaatttaacannnnnnngttgcatccacttgcacaagaa |
203 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11856185 |
tgtctatctggccgacattgtacatgactagcggatgttgtagcttgaaacaagcttgcttaaatttaacatttgtttgttgcatccacttgcacaagaa |
11856086 |
T |
|
| Q |
204 |
actgtcgaggctcaattattctagttacatgataggagtacaaaac |
249 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11856085 |
actgtcgagg--taattattctagttacatgataggagtacaaaac |
11856042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University