View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12737_low_35 (Length: 247)
Name: NF12737_low_35
Description: NF12737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12737_low_35 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 11 - 246
Target Start/End: Original strand, 41697541 - 41697776
Alignment:
| Q |
11 |
atgaagttgcgcccaatcccgccagctacaatttcatcttcagctggtggtactgaatttagagtgaatgcctaatgatcataaagaaaattttgttctt |
110 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41697541 |
atgaagttgcgcccaatcccaccagctacaatttcatcttcagctggtggtactgaatttagagtgaatgcctaatgatcataaagcaaattttgttctt |
41697640 |
T |
 |
| Q |
111 |
aatacttactttaatattaagagatcatttgaaataatagggaatttttaccaatccattgctattaaatgcaaatgcagagcttggaagctccccagca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41697641 |
aatacttactttaatattaagagatcatttgaaataatagggaatttttaccaatccattgctattaaatgcaaatgcagagcttggaagctccccagca |
41697740 |
T |
 |
| Q |
211 |
tatgtataagcaacaaagaatagcccatttggcaat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
41697741 |
tatgtataagcaacaaagaatagcccatttggcaat |
41697776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University