View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12737_low_36 (Length: 244)
Name: NF12737_low_36
Description: NF12737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12737_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 233
Target Start/End: Original strand, 11368846 - 11369061
Alignment:
| Q |
19 |
aataaaggattggatgtaggttaaaattagcaatgcaagatttcttatttcagtttttaaaaattagttgtttga-ccgctctctttatgaatgatcata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
11368846 |
aataaaggattggatgtaggttaaaattagcaatgcaagatttcttatttcagtttttaaaaattagttgtttgatccgccctctttatgaatgatcata |
11368945 |
T |
|
| Q |
118 |
aatgattggacgtcgggttcattgctaactttcatcctcaccaaagctaagtttcagtctgccactctttttaaccactggataacaaaattagatagtc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11368946 |
aatgattggacgtcgggttcattgctaactttcatcctcaccaaagctaagtttcagtctgccactctttttaaccactggataacaaaattagatagtc |
11369045 |
T |
|
| Q |
218 |
gtattcacatgttctt |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
11369046 |
gtattcacatgttctt |
11369061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 169 - 233
Target Start/End: Original strand, 11369062 - 11369126
Alignment:
| Q |
169 |
tttcagtctgccactctttttaaccactggataacaaaattagatagtcgtattcacatgttctt |
233 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11369062 |
tttcagtctgccactctttctaaccactagataacaaaattagatagtcgtattcacatgttctt |
11369126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University