View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12737_low_39 (Length: 243)
Name: NF12737_low_39
Description: NF12737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12737_low_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 17 - 133
Target Start/End: Complemental strand, 7966073 - 7965956
Alignment:
| Q |
17 |
tatgaggtttatattgtctttaatttttattattt-aaaaaagcaagcactccctttcagtcaccttcatccctagactcaccatagctaaccttgttaa |
115 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
7966073 |
tatgaagtttatattgtctttaatttttattattttaaaaaagcaagcactccctttcagtcaccttcatccctagactcaccatagttaaccttgttaa |
7965974 |
T |
|
| Q |
116 |
tttcaaggttattaactc |
133 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
7965973 |
tttcaaggttattaactc |
7965956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 210 - 243
Target Start/End: Complemental strand, 7965880 - 7965847
Alignment:
| Q |
210 |
ttaacattggaaacgttgggtagtaaaagggtaa |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7965880 |
ttaacattggaaacgttgggtagtaaaagggtaa |
7965847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University