View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12737_low_43 (Length: 232)
Name: NF12737_low_43
Description: NF12737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12737_low_43 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 20 - 221
Target Start/End: Original strand, 8910010 - 8910211
Alignment:
| Q |
20 |
agtatcttctccttcactagggtttgaaccttgaatcattaactttttcaacttctttaactcttagctcaaatcagttgaacaagatttacaaagatca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8910010 |
agtatcttctccttcactagggtttgaaccttgaatcattaactttttcaacttctttaactcttagctcaaatcagttgaacaagatttacaaagatca |
8910109 |
T |
|
| Q |
120 |
gtggtattaattcaaatatttggatgaaacttattttggatgaactcattggtcttctcatacggagtcaatcttgctcaagaaagcgtcacacagtgaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8910110 |
gtggtattaattcaaatatttggatgaaacttattttggatgaactcattggtcttctcatacggagtcaatcttgctcaagaaagcgtcacacaatgaa |
8910209 |
T |
|
| Q |
220 |
cg |
221 |
Q |
| |
|
|| |
|
|
| T |
8910210 |
cg |
8910211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 100
Target Start/End: Complemental strand, 15165298 - 15165256
Alignment:
| Q |
58 |
ttaactttttcaacttctttaactcttagctcaaatcagttga |
100 |
Q |
| |
|
|||||| |||||||||| |||||||| |||||||||||||||| |
|
|
| T |
15165298 |
ttaactctttcaacttcgttaactctaagctcaaatcagttga |
15165256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 73 - 102
Target Start/End: Original strand, 11660546 - 11660575
Alignment:
| Q |
73 |
tctttaactcttagctcaaatcagttgaac |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
11660546 |
tctttaactcttagctcaaatcagttgaac |
11660575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University