View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12737_low_45 (Length: 210)

Name: NF12737_low_45
Description: NF12737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12737_low_45
NF12737_low_45
[»] chr5 (1 HSPs)
chr5 (10-201)||(10114784-10114971)


Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 10 - 201
Target Start/End: Original strand, 10114784 - 10114971
Alignment:
10 agaagaagaaaagtgagtgacggcacgtgagtgagtgtgatagtatattgggagtgatcgagtgtggtgagctgttacgtgtcgacatggatgacacgtg 109  Q
    |||||||||||||||||| |||||||||||    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
10114784 agaagaagaaaagtgagttacggcacgtga----gtgtgatagtatattaggagtgatcgagtgtggtgagctgttacgtgtcgacatggatgacacgtg 10114879  T
110 gctgtttgtgattaattgaagttgttgtttggatttgggatctaaattcaatgctagtaacgtggtttggttgattgattgattcagtgaac 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10114880 gctgtttgtgattaattgaagttgttgtttggatttgggatctaaattcaatgctagtaacgtggtttggttgattgattgattcagtgaac 10114971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University