View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12737_low_46 (Length: 206)
Name: NF12737_low_46
Description: NF12737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12737_low_46 |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 51564 - 51399
Alignment:
| Q |
1 |
gtcgattggcattccgcttctataaactagatatatactacagatgtgaccatgattctatcttggtgagagtggcgtgacttgaagctgcacggagacc |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51564 |
gtcgattggcattccgcttctattaactagatatatactacagatgtgaccatgattctatcttggtgagagtggcgtgacttgaagctgcacggagacc |
51465 |
T |
 |
| Q |
101 |
atttccttttcttgctctcgtgctggatgtcatctcggcatatcggtcggtttaagatgaatccgg |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51464 |
atttccttttcttgctctcgtgctggatgtcatctcggcatatcggtcggtttaagatgaatccgg |
51399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 47 - 196
Target Start/End: Complemental strand, 24994834 - 24994685
Alignment:
| Q |
47 |
tgaccatgattctatcttggtgagagtggcgtgacttgaagctgcacggagaccatttccttttcttgctctcgtgctggatgtcatctcggcatatcgg |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24994834 |
tgaccatgattctatcttggtgagagtggcgtgacttgaagctgcacggagaccatttccttttcttgctctcgtgctggatgtcatctcggcatatcgg |
24994735 |
T |
 |
| Q |
147 |
tcggtttaagatgaatccgggggagggcctccattggccgttgacctttg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24994734 |
tcggtttaagatgaatccgggggagggcctccattggccgttgacctttg |
24994685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 93 - 149
Target Start/End: Original strand, 39928753 - 39928809
Alignment:
| Q |
93 |
cggagaccatttccttttcttgctctcgtgctggatgtcatctcggcatatcggtcg |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||| |||||| |||| |
|
|
| T |
39928753 |
cggagaccatttccttttcttgctctcgtgccggatgtcatctcgacatatcagtcg |
39928809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University