View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12737_low_7 (Length: 445)
Name: NF12737_low_7
Description: NF12737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12737_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 26 - 434
Target Start/End: Original strand, 27008917 - 27009316
Alignment:
| Q |
26 |
gtaatgcataacatactacaatttttccccctatcacaatttatccaccaatttgactggatgaacgttgtttatttttnnnnnnnnnnnnntacaattt |
125 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
27008917 |
gtaatgcataacataatacaatttatccccctatcacaatttatccaccaatttgactggatgaacattgtttatttttaataaaacaaaaatacaattt |
27009016 |
T |
|
| Q |
126 |
gtctccctcttgcagacggtcatctctaagacagtaaagtaaattattgtgtattggtcannnnnnncctaattactcaaaaatttactcaaaaattctc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
27009017 |
gtctccctcttgcagacggtcatctctaagacagtaaagtaaattattgtgtattggtcattattttcctaattac------------tcaaaaattctc |
27009104 |
T |
|
| Q |
226 |
catcacgccacatcgattttatgaaatatttcttagattattacacaaacatacatgtctggtttcatataacttggatgtgtgaaaagatcggtccatc |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27009105 |
catcacgccacatcgattttatgaaatatttcttagattattacacaaacatacatgtctggtttcatataacttggatgtgtgaaaagatcggtccatc |
27009204 |
T |
|
| Q |
326 |
ttagaccagtttgaaggaggcgaacggtttgctattattatattctccccgaggtgtgtaac-------cccgaaggctgttcgcatccctgtcacggga |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |||||||| |
|
|
| T |
27009205 |
ttagaccagtttgaaggaggcgaacggtttgctattattatattctccccgaggtgtgtaacaggaaagcccgaaggctgttc----ccctctcacggga |
27009300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.0000000002; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 388 - 434
Target Start/End: Original strand, 4686181 - 4686227
Alignment:
| Q |
388 |
cccgaaggctgttcgcatccctgtcacgggagatgccaactatctct |
434 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||| |||||| |
|
|
| T |
4686181 |
cccgaaggctgttcccatccctgtcaggggagatgccaaccatctct |
4686227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 388 - 434
Target Start/End: Complemental strand, 4681381 - 4681335
Alignment:
| Q |
388 |
cccgaaggctgttcgcatccctgtcacgggagatgccaactatctct |
434 |
Q |
| |
|
|||||| ||||||| ||||||||||| ||||||||||||| |||||| |
|
|
| T |
4681381 |
cccgaaagctgttcccatccctgtcaggggagatgccaaccatctct |
4681335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 388 - 434
Target Start/End: Original strand, 4763829 - 4763875
Alignment:
| Q |
388 |
cccgaaggctgttcgcatccctgtcacgggagatgccaactatctct |
434 |
Q |
| |
|
|||||| ||||||| ||||||||||| ||||||||||||| |||||| |
|
|
| T |
4763829 |
cccgaaagctgttcccatccctgtcaggggagatgccaaccatctct |
4763875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University