View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12738_high_24 (Length: 205)

Name: NF12738_high_24
Description: NF12738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12738_high_24
NF12738_high_24
[»] chr3 (1 HSPs)
chr3 (14-183)||(54619881-54620050)


Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 14 - 183
Target Start/End: Complemental strand, 54620050 - 54619881
Alignment:
14 cagagacaaaatatgattctaataaattggagacaaagaaatgtctgcccataacactcctttacaccgcatacttagagctatgtattcatcattctgt 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54620050 cagagacaaaatatgattctaataaattggagacaaagaaatgtctgcccataacactcctttacaccgcatacttagagctatgtattcatcattctgt 54619951  T
114 ggcttagctatcactgtctcaatcaacaccctcttattctgtccccaattggctactttatgatggtcca 183  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54619950 ggcttagctatcactgtctcaatcaacaccctcttattctgtccccaattggctactttatgatggtcca 54619881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University