View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12738_low_28 (Length: 205)
Name: NF12738_low_28
Description: NF12738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12738_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 14 - 183
Target Start/End: Complemental strand, 54620050 - 54619881
Alignment:
| Q |
14 |
cagagacaaaatatgattctaataaattggagacaaagaaatgtctgcccataacactcctttacaccgcatacttagagctatgtattcatcattctgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54620050 |
cagagacaaaatatgattctaataaattggagacaaagaaatgtctgcccataacactcctttacaccgcatacttagagctatgtattcatcattctgt |
54619951 |
T |
 |
| Q |
114 |
ggcttagctatcactgtctcaatcaacaccctcttattctgtccccaattggctactttatgatggtcca |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54619950 |
ggcttagctatcactgtctcaatcaacaccctcttattctgtccccaattggctactttatgatggtcca |
54619881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University