View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12738_low_4 (Length: 449)
Name: NF12738_low_4
Description: NF12738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12738_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 4e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 40290345 - 40290145
Alignment:
| Q |
1 |
agagatattacaattcatgtagaaactgtctgccgtaaggatgagatagtacgacccatgtctaaactgcttaccattacgaagagatcataccacttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40290345 |
agagatattacaattcatgtagaaactgtctgccgtaaggataagatagtacgacccatgtctaaactgtttaccattacgaagagatcataccacttat |
40290246 |
T |
 |
| Q |
101 |
gaattatgttctgt--atattgaacatcataagctacattaattaagagataattttgtatctcatgtggtaagtgctcacaatgtttctatatgtgtgt |
198 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40290245 |
gaattatgttctgtacatattgaacatcataagctac---aattaagagataa---tgtatctcatgtggtaagtgctcacaatgtttctatatgtgtgt |
40290152 |
T |
 |
| Q |
199 |
tgtttaa |
205 |
Q |
| |
|
||||||| |
|
|
| T |
40290151 |
tgtttaa |
40290145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University