View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12739_low_7 (Length: 238)
Name: NF12739_low_7
Description: NF12739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12739_low_7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 51370278 - 51370056
Alignment:
| Q |
16 |
ggatcaagccgtaaacatgtgtagcccaccaaagtggcttcctttcgatacaattgtttatctcaaaccttatgagatgatgagaataaaggaatctgtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51370278 |
ggatcaagccgtaaacatgtgtagcccaccaaagtggcttcctttcgaaacaattgtttatctcaaaccttatgagatgatgagaataaaggaatctgtt |
51370179 |
T |
|
| Q |
116 |
aagaatgagtcttgtggaaaaacagtcactacttctgataccagcaaattattcacaagtgctgacatgtttcttattagcacctctaacgacattgaag |
215 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| ||||||| || |||||| |
|
|
| T |
51370178 |
aagaatgagtctggtggaaaaacagtcactactgctgataccagcaaagtattcacaagtgctgacatgtttcttattagaacctctagagaacttgaag |
51370079 |
T |
|
| Q |
216 |
gtccatggttagattatctttct |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
51370078 |
gtccatggttagattatctttct |
51370056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University