View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273_high_11 (Length: 328)
Name: NF1273_high_11
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 37 - 320
Target Start/End: Complemental strand, 51687282 - 51686999
Alignment:
| Q |
37 |
ctttcaacgagttcacggaagacagggttgtcaacaacgtcggaggtgacacggtagaggcggcgagattttcctacgaagacggtgtggaggtcggatc |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
51687282 |
ctttcaacgagttcacggaagacagggttgtcaacaacgtcggaggtgacacggtagaggcggcgagactttcctacgaagacggtgtggaggtcggatc |
51687183 |
T |
|
| Q |
137 |
ttgaagacgatgagtcttcgtcggcgacggcgctgatgctgtgacggctctgttttccgtttccaaatgagttccattttttgagtgctgattttagctt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51687182 |
ttgaagacgatgagtcttcgtcggcgacggcgctgatgctgtgacggctctgttttccgtttccaaatgagttccattttttgagtgctgattttagctt |
51687083 |
T |
|
| Q |
237 |
cattagctttccaccttttgccatgtttggtttgtagtaatacaaatgcaatgaaaatatgtttggttagttattagtattatc |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51687082 |
cattagctttccaccttttgccatgtttggtttgtagtaatacaaatgcaatgaaaatatgtttggttagttattagtattatc |
51686999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University