View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273_high_22 (Length: 254)
Name: NF1273_high_22
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 23 - 156
Target Start/End: Original strand, 49106123 - 49106256
Alignment:
| Q |
23 |
aaaatatatatgacaagggtttggcttatggataagtacataacatgggatttccttacacaaactagtaataaattgagcacattgtgnnnnnnnatga |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| || |||| |
|
|
| T |
49106123 |
aaaatatatatgacaagggtttggcttatggataagtgcataacatgggatttccttccacaaactagtaataaattgagcacattatgtttttttatga |
49106222 |
T |
 |
| Q |
123 |
gtcctgacttgaactcacacatgcatgtgcatat |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
49106223 |
gtcctgacttgaactcacacatgcatgtgcatat |
49106256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University