View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273_high_24 (Length: 251)
Name: NF1273_high_24
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273_high_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 29 - 243
Target Start/End: Original strand, 37220271 - 37220485
Alignment:
| Q |
29 |
atctaggccctggatttggtgctatagcagatgcacgcagttacacgccgttttcaatatcagccgttcctttaagatcgaaagattaaaattgacaact |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37220271 |
atctaggccctggatttggtgctatagcagatgcacgcagttacacgccgttttcaatatcagccgttcctttaagatcgaaagattaaaattgacaact |
37220370 |
T |
 |
| Q |
129 |
attaaattgatcatgatcgtataattcttatcagaaagctcatatactttacagcacgctgtggttacagaccctgcagttacagcaggaaatctgcttt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37220371 |
attaaattgatcatgatcgtataattcttatcagaaagctcatatactttacagcaccctgtggttacagaccctgcagttacagcaggaaatctgcttt |
37220470 |
T |
 |
| Q |
229 |
ccatgcatataataa |
243 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
37220471 |
ccatgcatataataa |
37220485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University