View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1273_high_28 (Length: 227)

Name: NF1273_high_28
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1273_high_28
NF1273_high_28
[»] chr1 (1 HSPs)
chr1 (43-227)||(49180660-49180844)


Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 49180844 - 49180660
Alignment:
43 tagttcggttcaccgcctaaaccaagaacaaattatacaagcataacgacaagcagggctgtttttaaagagttttgtatcagattgcagaaaatttatg 142  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
49180844 tagttcggttcaccgcctaaaccaagaacaaattatacaagcataaagacaagcagggctgtttttaaagagttttgtatcagattgcagaaaatttatg 49180745  T
143 aaaacttgagacttcggtgagttattggatcagaaccacaaaggggcatagcaaattgaaattaaattcaagacaacaagagaaa 227  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49180744 aaaacttgagacttgggtgagttattggatcagaaccacaaaggggcatagcaaattgaaattaaattcaagacaacaagagaaa 49180660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University