View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273_high_28 (Length: 227)
Name: NF1273_high_28
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273_high_28 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 43 - 227
Target Start/End: Complemental strand, 49180844 - 49180660
Alignment:
| Q |
43 |
tagttcggttcaccgcctaaaccaagaacaaattatacaagcataacgacaagcagggctgtttttaaagagttttgtatcagattgcagaaaatttatg |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180844 |
tagttcggttcaccgcctaaaccaagaacaaattatacaagcataaagacaagcagggctgtttttaaagagttttgtatcagattgcagaaaatttatg |
49180745 |
T |
 |
| Q |
143 |
aaaacttgagacttcggtgagttattggatcagaaccacaaaggggcatagcaaattgaaattaaattcaagacaacaagagaaa |
227 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180744 |
aaaacttgagacttgggtgagttattggatcagaaccacaaaggggcatagcaaattgaaattaaattcaagacaacaagagaaa |
49180660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University