View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273_low_14 (Length: 386)
Name: NF1273_low_14
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 24 - 313
Target Start/End: Complemental strand, 33824235 - 33823946
Alignment:
| Q |
24 |
tcatcatgtgagaaacatgggaccctatgaagttattgccttcttccttaacatgattagggttagggttttggttttgactagatcttagcaaagaaag |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33824235 |
tcatcatgtgagaaacatgggaccctatgaagttattgccttcttccttaacatgattagggttagggttttggttttgactagatcttagcaaagaaag |
33824136 |
T |
 |
| Q |
124 |
tatatgagaattttgaggagaaccccagaggatttgactttgtggtggaacaacgtgttcgagatcaaacccttgaccacttgttgaccttccaataaac |
223 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33824135 |
tatatgagaattttgaggagaaccccataggatttgactttgtggtggaacaacgtgttcgagatcaaacccttgaccacttgttgaccttccaataaac |
33824036 |
T |
 |
| Q |
224 |
tccgaagaagaaactgttttcatcttgtttgtagctatttttgccgtgttgtttgaggcaccgatgctcttgtttttccggcagccacct |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33824035 |
tccgaagaagaaactgttttcatcttgtttgtagctatttttgccgcgttgtttgaggcaccgatgctcttgtttttccggcagccacct |
33823946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University