View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273_low_17 (Length: 380)
Name: NF1273_low_17
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 52035841 - 52035632
Alignment:
| Q |
1 |
tgttgacaaatactaatattgtagaagcttcacagataataagttctctcccgacaatgtatatcatagctcatacggcaagttgagtcgagttaaaaat |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
52035841 |
tgtttacaaatactaatattgtagaagcttcacagataataagttctctcccgacaatgtatatcatcgctcatacggcaagttgagtcgagttaaaaat |
52035742 |
T |
 |
| Q |
101 |
gacatgagatgcttttgatcacaatattgacaaaacgatgcaatgagtgtgtattaaattttagctactttatttatttcattctctaaaaaatgacact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035741 |
gacatgagatgcttttgatcacaatattgacaaaacgatgcaatgagtgtgtattaaattttagctactttatttatttcattctctaaaaaatgacact |
52035642 |
T |
 |
| Q |
201 |
tttttaaaaa |
210 |
Q |
| |
|
||| |||||| |
|
|
| T |
52035641 |
tttgtaaaaa |
52035632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 240 - 291
Target Start/End: Complemental strand, 52035641 - 52035590
Alignment:
| Q |
240 |
tttgtaaaaattgaatgaaagattgtgaaagaaaaagcatattattcgtatc |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035641 |
tttgtaaaaattgaatgaaagattgtgaaagaaaaagcatattattcgtatc |
52035590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 317 - 351
Target Start/End: Complemental strand, 52035589 - 52035555
Alignment:
| Q |
317 |
aatgaaccactttattctctctgaccaatttcaac |
351 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
52035589 |
aatgaaccactttattgtctctgaccaatttcaac |
52035555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University