View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273_low_21 (Length: 353)
Name: NF1273_low_21
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 9e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 9e-61
Query Start/End: Original strand, 93 - 255
Target Start/End: Original strand, 44386131 - 44386296
Alignment:
| Q |
93 |
acatataaatggcaattgaatgtagaaaccaaaatcatatgaatatgctgtcnnnnnnngtattcaaatattcatatagatttagctccctcaaaacaaa |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44386131 |
acatataaatggcaattgaatgtagaaaccaaaatcatacgaatatgctgtcaaaaaaagtattcaaatatgcatatagatttagctccctcaaaacaaa |
44386230 |
T |
|
| Q |
193 |
aaag---gatatagatttagtagaattttgttgcaccttatttaactgaagcttgtgcgtcaagtc |
255 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44386231 |
aaaaaaagatatagatttagtagaattttgttgcaccttatttaactgaagcttgtgcgtcaagtc |
44386296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University