View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273_low_26 (Length: 334)
Name: NF1273_low_26
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 93 - 305
Target Start/End: Original strand, 49180499 - 49180710
Alignment:
| Q |
93 |
catactattcatggttcctcacatgttattatagataaaatgatatgcccaatccttgcnnnnnnnntggtgagttttgtgagatacgcctgtgcaagca |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49180499 |
catactattcatggttcctcacatgttattacagataaaatgatatgcccaatccttgcgaaaaaa-tggtgagttttgtgagatacgcctgtgcaagca |
49180597 |
T |
|
| Q |
193 |
tggatcaatctgtgttttttggaaagaaacttttgtctggattgtaagcgttcgctgtgctgtttctcttgttgtcttgaatttaatttcaatttgctat |
292 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180598 |
tggatcaatctgtgtttttctgaaagaaacttttgtctggattgtaagcgttcgctgtgctgtttctcttgttgtcttgaatttaatttcaatttgctat |
49180697 |
T |
|
| Q |
293 |
gcccctctgtggt |
305 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
49180698 |
gcccctttgtggt |
49180710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University