View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273_low_35 (Length: 316)
Name: NF1273_low_35
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 102 - 241
Target Start/End: Complemental strand, 1602511 - 1602372
Alignment:
| Q |
102 |
cagcaggttgggaacagtaatagtctagatctaatgatcgttgaaggatgttaattactagatgttggaccattacaacttacgagttggatatgattca |
201 |
Q |
| |
|
||||||||||| || ||||||| |||||||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
1602511 |
cagcaggttggaaaaagtaataatctagatctaatgatcgttgaaggatgttagttactagatgttgggccgttacaacttacgagttggatatgattca |
1602412 |
T |
 |
| Q |
202 |
atgatgatgatgatgagtcatggtggattgacctttgctt |
241 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1602411 |
atgatgatgatgatgagttatggtggattgacctttgctt |
1602372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University