View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273_low_36 (Length: 315)
Name: NF1273_low_36
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 8e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 79 - 257
Target Start/End: Complemental strand, 36011136 - 36010958
Alignment:
| Q |
79 |
tatcatcacacacacattcgatcaatccatcagttgatccattccaacaaacaacatggatagggtattctcagtggacgaaatccccgaccatctttgg |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36011136 |
tatcatcacacacacattcgatcaatccatcagttgatccattccaacaaacaacatggatagggtattctcagtggacgaaatccccgaccatctatgg |
36011037 |
T |
|
| Q |
179 |
tcaccgcagattcatatctccggcagcgccggcgatgaatcctccaagatgagtcgcagcgcttccgaatgggcgttcc |
257 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36011036 |
tcaccgcagattcatgtctccggcagcgccggcgatgaatcctccaagatgagtcgcagcgcttccgaatgggcgttcc |
36010958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University