View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273_low_42 (Length: 291)
Name: NF1273_low_42
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 51 - 262
Target Start/End: Original strand, 49180499 - 49180710
Alignment:
| Q |
51 |
catactattcatggttcctcacatgttattatagataaaatgatatgcccaatccttgcnnnnnnntggtgagttttgtgagatacgcctgtgcaagcat |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49180499 |
catactattcatggttcctcacatgttattacagataaaatgatatgcccaatccttgcgaaaaaatggtgagttttgtgagatacgcctgtgcaagcat |
49180598 |
T |
 |
| Q |
151 |
ggatcaatctgtgttttttggaaagaaacttttgtctggattgtaagcgttcgctgtgctgtttctcttgttgtcttgaatttaatttcaatttgctatg |
250 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49180599 |
ggatcaatctgtgtttttctgaaagaaacttttgtctggattgtaagcgttcgctgtgctgtttctcttgttgtcttgaatttaatttcaatttgctatg |
49180698 |
T |
 |
| Q |
251 |
cccctctgtggt |
262 |
Q |
| |
|
||||| |||||| |
|
|
| T |
49180699 |
cccctttgtggt |
49180710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University