View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273_low_43 (Length: 291)
Name: NF1273_low_43
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 75 - 194
Target Start/End: Complemental strand, 32327358 - 32327239
Alignment:
| Q |
75 |
ggagcagagacaaatgttggtggaaatggaatagcaaagatcacaacacattgtctcacacctaggattggacgtttagagtgcagtcatatacgagcta |
174 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32327358 |
ggagcagggacaaatgttggtggaaatggaatagcaaagatcacaacacattgtctcacacctaggattggacgtttagagtgcagtcatatacgagcta |
32327259 |
T |
 |
| Q |
175 |
cccactaacagacatgtttg |
194 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
32327258 |
cccactaacagacatgtttg |
32327239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University