View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273_low_46 (Length: 282)
Name: NF1273_low_46
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273_low_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 61 - 195
Target Start/End: Complemental strand, 27879377 - 27879243
Alignment:
| Q |
61 |
catgtaagaattgaccagcatcatctttaaaacaaagacctactgccataatggatgatgctagcgtagcaagtctgtaataaactatgattgtctannn |
160 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27879377 |
catgtaagaattgaccagcatcatctctaaaacaaagacctactgccataatggatgatgctagcgtagcaagtctgtaataaactatgattgtctattt |
27879278 |
T |
|
| Q |
161 |
nnnnnnncttcacaatagtatgttcctagttgtat |
195 |
Q |
| |
|
|||||||||||||||||| ||||||||| |
|
|
| T |
27879277 |
tttttttcttcacaatagtatgttcatagttgtat |
27879243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University