View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273_low_55 (Length: 261)
Name: NF1273_low_55
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273_low_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 12 - 162
Target Start/End: Original strand, 43817910 - 43818060
Alignment:
| Q |
12 |
aatgaaaactaagatatgattatttggattcaataaagggattgttacttcgttttggtttcatcaacatgatannnnnnngggtttgatctaccttaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43817910 |
aatgaaaactaagatatgattatttggattcaataaagggattgttacttcgttttggtttcatcaacatgatatttttttgggtttgatctaccttaaa |
43818009 |
T |
|
| Q |
112 |
ggtagattgggagagacggttaccaaaccctcaggtgaataatattcttcg |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43818010 |
ggtagattgggagagacggttaccaaaccctcaggtgaataattttcttcg |
43818060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University