View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273_low_58 (Length: 252)
Name: NF1273_low_58
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273_low_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 44314053 - 44313828
Alignment:
| Q |
1 |
attgtacgagatctttactagtggatcattatttgttttcataaattttatgtactatatgtatgtgaaatactacttacataagtatctagttgttttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44314053 |
attgtacgagatctttactagtggatcattatttgttttcataaattttatgtactatatgtatgtgaaatactacttacataagtatctagttgttttg |
44313954 |
T |
 |
| Q |
101 |
gttttcatgaatagatgcaataagcatagtttatgacttggttcatgctnnnnnnntgtgatagttaa---tatggttgtgtcttatgagacctaattta |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44313953 |
gttttcatgaatagatgcaataagcatagtttatgacttggttcatgctaaaaaaatgtgatagttaatattatggttgtgtcttatgagacctaattta |
44313854 |
T |
 |
| Q |
198 |
acgttttccttgatgctttatttaat |
223 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
44313853 |
acgttttccttgatgctttatttaat |
44313828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University