View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273_low_62 (Length: 250)
Name: NF1273_low_62
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273_low_62 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 44869571 - 44869805
Alignment:
| Q |
1 |
ttgaatttgtagagaccaaatctaaacaagaaaacttatagggactaacaccaaaaaccgctataatcgcatggctaaaattatatttgaacaaaacaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44869571 |
ttgaatttgtagagaccaaatctaaacaagaaaacttatagggactaacaccaaaaaccgctataatcgcatggctaaaattatatttgaacaaaacaaa |
44869670 |
T |
|
| Q |
101 |
tttatgcttatagaatttcttttgcttcaggtttacttgnnnnnnnnnnnngcacagctgtgtctgacaaaatgttcccaagtgccttaattatgaatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44869671 |
tttatgcttatagaatttcttttgcttcaggtttactt--tttttttttttgcgcagctgtgtctgacaaaatgttcccaagtgccttaattatgaatga |
44869768 |
T |
|
| Q |
201 |
ctctgaaattgtgctggtgagtttctttttgcaacag |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44869769 |
ctctgaaattgtgctggtgagtttctttttgcaacag |
44869805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University