View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273_low_65 (Length: 232)
Name: NF1273_low_65
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273_low_65 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 85 - 232
Target Start/End: Original strand, 29024997 - 29025144
Alignment:
| Q |
85 |
aggacatgtgagcaattgagaagattaatgaaacgactttctttcttttttactttatatatgttagaagtctagagatccgatatcatctcatatgtat |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29024997 |
aggacatgtgagcaattgagaagattaatgaaacgactttctttcttttttactttataaatgttagaagtctagagacccgatatcatctcatatgtat |
29025096 |
T |
|
| Q |
185 |
ctcatcgggtttatgccattgtcgtacaatattgtattttcttaaagt |
232 |
Q |
| |
|
|||||| | ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29025097 |
ctcatccgatttatgctattgtcgtacaatattgtattttcttaaagt |
29025144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University