View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1273_low_74 (Length: 210)
Name: NF1273_low_74
Description: NF1273
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1273_low_74 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 12 - 119
Target Start/End: Original strand, 17443555 - 17443663
Alignment:
| Q |
12 |
tgtgtagttcataatttattcatgatgttgggtgagagtagctctccatgtttggccttatttc-tttctagtttcacgaca-tttttgttattatccaa |
109 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
17443555 |
tgtgtagttcataatttattcatgttgttgggtgagagtagctctccatgtttggcc-tatttcttttctagtttcacgacatttttttttattatccaa |
17443653 |
T |
 |
| Q |
110 |
atgtacttat |
119 |
Q |
| |
|
|||||||||| |
|
|
| T |
17443654 |
atgtacttat |
17443663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University