View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1274-Insertion-1 (Length: 280)
Name: NF1274-Insertion-1
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1274-Insertion-1 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 130 - 280
Target Start/End: Original strand, 1458856 - 1459008
Alignment:
| Q |
130 |
cactaatgattaaagtgcttgcttggtgtctagtaattcaaatataaaattaatgaaacaatagagg--atagagaaactactacttgcttacttaatca |
227 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| | |
|
|
| T |
1458856 |
cactaatgattaaagtgcttgctttgtgtctagtaattcaaatataaaattaatgaaacaacagagagaatagagaaactactacttgcttacttaataa |
1458955 |
T |
|
| Q |
228 |
tattgttccgaataaaccgagagtttacatgttgcagacgcccttgaacttga |
280 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1458956 |
tattgttccaaataaaccgagagtttacatgttgcagacacccttgaacttga |
1459008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University