View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1274-Insertion-3 (Length: 276)
Name: NF1274-Insertion-3
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1274-Insertion-3 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 8 - 276
Target Start/End: Original strand, 24717666 - 24717934
Alignment:
| Q |
8 |
aaaggcattgaccattgtttgagagtctgtttcaatccagatattacgccagttcagcttctttgttatttcaacaacaaacatcaaagcacacagctct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24717666 |
aaaggcattgaccattgtttgagagtctgtttcaatccagatattacgccagttcagcttctttgttatttcaacaacaaacatcaaagcacatagctct |
24717765 |
T |
|
| Q |
108 |
atagtaaatgcaattgggatgcctatattctgcacgaatccacccttaaaattggcatagccatctctgaatatgacttcaatagaagcagataaaggat |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
24717766 |
atagtaaatgcaattgggatgcttatattctgcacgaatccacccttaaaattggcatagccatctctgagtatgacttcaatagaagcagatgaaggat |
24717865 |
T |
|
| Q |
208 |
caccaaaggtcgagccatcaatgttggccttaatccaaccaggcgcaggtggaatccacctaacttcaa |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24717866 |
caccaaaggtcgagccatcaatgttggccttaatccaaccaggcgcaggtggaatccacctaacttcaa |
24717934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University