View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12740_high_19 (Length: 357)
Name: NF12740_high_19
Description: NF12740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12740_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 28 - 255
Target Start/End: Complemental strand, 7469024 - 7468793
Alignment:
| Q |
28 |
gctatgtgtgcattcttgtcaacatcaacctatccaagagaatttttgaagaggtggtggttgaacttgagggctttgcgttctgtgttgacattgttta |
127 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7469024 |
gctatgtgtgcattctagtcaacatcaacctatccaagagaatttttgaagaggtggtggttgaacttgagggctttgcgttctgtgttgacattgttta |
7468925 |
T |
 |
| Q |
128 |
tgatagatcacctaagttttgcaccaattgtttaaccattggacactcaatttctctttgcaacaagctacaccccaagaacaaggaggaaatggtgaag |
227 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7468924 |
tgatagattacctaagttttgcaccaattgtttaaccattggacactcaatatctctttgcaacaagctacaccccaagaacaaggaggaaatggtgaag |
7468825 |
T |
 |
| Q |
228 |
ccga----ataaacccaaaatgaagggtgatt |
255 |
Q |
| |
|
| || |||||||||||||||||||||||| |
|
|
| T |
7468824 |
ctgaatatataaacccaaaatgaagggtgatt |
7468793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 113 - 261
Target Start/End: Complemental strand, 8304401 - 8304253
Alignment:
| Q |
113 |
tgttgacattgtttatgatagatcacctaagttttgcaccaattgtttaaccattggacactcaatttctctttgcaacaagctacaccccaagaacaag |
212 |
Q |
| |
|
|||| ||||||||||||| |||| | ||||||| |||||||||| | ||| || |||| | |||||||| ||||||| | ||||| ||||||| |
|
|
| T |
8304401 |
tgtttacattgtttatgaaagattgtatgagttttgttccaattgtttcaacatagggcacttagtttctcttcgcaacaaattgcacccagagaacaat |
8304302 |
T |
 |
| Q |
213 |
gaggaaatggtgaagccgaataaacccaaaatgaagggtgattcttcta |
261 |
Q |
| |
|
||||| | |||||||||| ||||| ||||| |||||||||||| ||||| |
|
|
| T |
8304301 |
gaggatagggtgaagccggataaagccaaattgaagggtgattattcta |
8304253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University