View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12740_high_28 (Length: 296)
Name: NF12740_high_28
Description: NF12740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12740_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 15 - 277
Target Start/End: Original strand, 3435624 - 3435886
Alignment:
| Q |
15 |
gattcgaatttatggagtttctttgcaagcatggaatggaannnnnnnnagattatgtgcttttgattttggtcgattgttgagggtagataactgcacg |
114 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3435624 |
gattcgaatttacggagtttctttgcaagcatggaatgggaaattttttagattatgtgcttttgattttggtcgattgttgagggtagataattgcacg |
3435723 |
T |
 |
| Q |
115 |
gttgctagagaatggtttgattatgttcgtattttattggcaacttcatccctagaggttattaatgacgaagctgatttgttggttgatgatgatttgg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3435724 |
gttgctagagaatggtttgattatgttcgtattttattggcaacttcatccctagagattattaatgacgaagctgatttgttggttgatgatgatttgg |
3435823 |
T |
 |
| Q |
215 |
tgaatattaaaataatggaggaatggggattctcattaggcgaggatgcttgtttgtttgagg |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3435824 |
tgaatattaaaataatggaggaatggggattctcattaggcgaggatgcttgtttgtttgagg |
3435886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 64 - 277
Target Start/End: Complemental strand, 17964370 - 17964157
Alignment:
| Q |
64 |
agattatgtgcttttgattttggtcgattgttgagggtagataactgcacggttgctagagaatggtttgattatgttcgtattttattggcaacttcat |
163 |
Q |
| |
|
||||||||||||||||||||| ||||| |||| |||| |||| ||||||||| ||||||| ||| |||||| | ||||||||||||| || |||| | |
|
|
| T |
17964370 |
agattatgtgcttttgattttagtcgaatgttacgggtggatagttgcacggtttatagagaaaggtatgattacgctcgtattttattgccagcttctt |
17964271 |
T |
 |
| Q |
164 |
ccctagaggttattaatgacgaagctgatttgttggttgatgatgatttggtgaatattaaaataatggaggaatggggattctcattaggcgaggatgc |
263 |
Q |
| |
|
|| | |||||||| || | ||| || ||||||||||||||||||| |||| ||||||||||||| | ||||| | ||| || | || ||||||||||| |
|
|
| T |
17964270 |
ccttggaggttataaaagccgacgcagatttgttggttgatgatgctttgatgaatattaaaattgtagaggatttgggttttccgttcggcgaggatgc |
17964171 |
T |
 |
| Q |
264 |
ttgtttgtttgagg |
277 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
17964170 |
ttgtttatttgagg |
17964157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University