View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12740_high_36 (Length: 240)
Name: NF12740_high_36
Description: NF12740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12740_high_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 101 - 222
Target Start/End: Original strand, 34628142 - 34628263
Alignment:
| Q |
101 |
ttatagaaatgcacttattatctaggacatgannnnnnnnnnggacgaaagctatttcaaccaaactaaggataactgattcattctcaagtatatagtt |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34628142 |
ttatagaaatgcacttattatttaggacatgattttttttttggaagaaagctatttcaaccaaactaaggataactgattcattctcaagtatatagtt |
34628241 |
T |
|
| Q |
201 |
cgaggatatttaagatcaaaaa |
222 |
Q |
| |
|
| ||||| |||||||||||||| |
|
|
| T |
34628242 |
caaggatctttaagatcaaaaa |
34628263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University