View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12740_low_38 (Length: 278)
Name: NF12740_low_38
Description: NF12740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12740_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 110 - 256
Target Start/End: Complemental strand, 39141117 - 39140970
Alignment:
| Q |
110 |
agtgatagtcgtttcttttatatctaatatt-aacgcattcatcggcaatgttaaactaaccactaacacttaaatccaactaaagacaaacatacagga |
208 |
Q |
| |
|
|||| ||||| |||||||||||||||||||| |||||| |||||| | |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39141117 |
agtggtagtcatttcttttatatctaatatttaacgcactcatcgtcgatgttaaactaaccactaacacttaaatccaacttaagacaaacatacagga |
39141018 |
T |
|
| Q |
209 |
aatggtaaattcgcaagcacatatatataagcaatgaattgcaagtag |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39141017 |
aatggtaaattcgcaagcacatatatataagcaatgaattgcaagtag |
39140970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 39141392 - 39141310
Alignment:
| Q |
19 |
gtcaggctaatgatgagaatcatcaagaaattgagatatcatagctctactcaaaattttaaagcatttagtatatgagtcaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39141392 |
gtcaggctaatgatgagaatcatcaagaaattgagacatcatagcactactcaaaattttaaagcatttagtatatgagtcaa |
39141310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University