View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12740_low_42 (Length: 244)
Name: NF12740_low_42
Description: NF12740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12740_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 10 - 228
Target Start/End: Original strand, 36788588 - 36788806
Alignment:
| Q |
10 |
gcagagatacggtgtgttataaggtcgcatttgacgcagtaccagtcacagcaatctgtctgtgggtcccatgaggctagaagataagggttgttgagtt |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36788588 |
gcagtgatacggtgtgttataaggtcgcatttgacgcagtaccagccacagcaatctgtctgtgggtcccatgaggctagaagataagggttgttgagtt |
36788687 |
T |
 |
| Q |
110 |
ctttcttgattctgagaagcaccctcttgtcttgtgggttgcatttctctgaaaatgcaattggggagagtagtaggaagaaggagaagaagcatagaac |
209 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36788688 |
ctttcttgatcctgagaagcaccctcttgtcttgtgggttgcatttctctgaaaatgcaattggggagagtagtaggaagaaggagaagaagcatagaac |
36788787 |
T |
 |
| Q |
210 |
tattgaagctccaccaaac |
228 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36788788 |
tattgaagctccaccaaac |
36788806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 96 - 157
Target Start/End: Original strand, 36779896 - 36779957
Alignment:
| Q |
96 |
agggttgttgagttctttcttgattctgagaagcaccctcttgtcttgtgggttgcatttct |
157 |
Q |
| |
|
||||||||||||||| ||||||||| ||| | | | |||||||||||||||||||||||| |
|
|
| T |
36779896 |
agggttgttgagttccttcttgatttggagcaacgctttcttgtcttgtgggttgcatttct |
36779957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University