View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12740_low_50 (Length: 238)
Name: NF12740_low_50
Description: NF12740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12740_low_50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 217
Target Start/End: Complemental strand, 35036971 - 35036774
Alignment:
| Q |
20 |
caaataaaaaatagaaaacaccgccttctcccacttcttagtgttttcataggttgtttatgtcaattgttttgaacccgtgtttcaaaaaccggacagg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35036971 |
caaataaaaaatagaaaacaccgccttctcccacttcttagtgttttcataggttgtttatgtcaattgttttgaacccgtgtttcaaaaaccggacagg |
35036872 |
T |
 |
| Q |
120 |
ccatcgaaccaacaaggttatgagttcaagggttcattggttgtaccatgggtcactgattgaactgcatgaccaaaccaaacaaaaccgaatgactc |
217 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35036871 |
ccatcgaatcgacaaggttatgagttcaagggttcattggttgtaccatgagtcactgattgaactgcatgaccaaaccaaacaaaaccgaatgactc |
35036774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University