View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12740_low_51 (Length: 236)
Name: NF12740_low_51
Description: NF12740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12740_low_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 77 - 219
Target Start/End: Complemental strand, 39140908 - 39140765
Alignment:
| Q |
77 |
gaataaagaaggaacgttgaatggtaattttcgagaaaatgaaggagaaaaagaaataaaa-tggagtcaataacatctctttgaagtgaatgcccttat |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
39140908 |
gaataaagaaggaacgttgaatggtaattttcgagaaaatgaaggagaaaaagaaataaaaatggagtcaataacatctctttgaagtggatgccctttt |
39140809 |
T |
 |
| Q |
176 |
tattggtgaacttttaaagcgaatgtcatggtacaaatactaca |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39140808 |
cattggtgaacttttaaagcgaatgtcatggtacaaatactaca |
39140765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 39140971 - 39140920
Alignment:
| Q |
43 |
agagcaaaatctcaaaaaacttgacaaaaataaagaataaagaaggaacgtt |
94 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39140971 |
agagcaaaatctcaaaaaatttgacaaaaataaagaataaagaaggaacgtt |
39140920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University