View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12740_low_51 (Length: 236)

Name: NF12740_low_51
Description: NF12740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12740_low_51
NF12740_low_51
[»] chr3 (2 HSPs)
chr3 (77-219)||(39140765-39140908)
chr3 (43-94)||(39140920-39140971)


Alignment Details
Target: chr3 (Bit Score: 124; Significance: 6e-64; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 77 - 219
Target Start/End: Complemental strand, 39140908 - 39140765
Alignment:
77 gaataaagaaggaacgttgaatggtaattttcgagaaaatgaaggagaaaaagaaataaaa-tggagtcaataacatctctttgaagtgaatgcccttat 175  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |    
39140908 gaataaagaaggaacgttgaatggtaattttcgagaaaatgaaggagaaaaagaaataaaaatggagtcaataacatctctttgaagtggatgccctttt 39140809  T
176 tattggtgaacttttaaagcgaatgtcatggtacaaatactaca 219  Q
     |||||||||||||||||||||||||||||||||||||||||||    
39140808 cattggtgaacttttaaagcgaatgtcatggtacaaatactaca 39140765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 43 - 94
Target Start/End: Complemental strand, 39140971 - 39140920
Alignment:
43 agagcaaaatctcaaaaaacttgacaaaaataaagaataaagaaggaacgtt 94  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||    
39140971 agagcaaaatctcaaaaaatttgacaaaaataaagaataaagaaggaacgtt 39140920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University