View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12740_low_58 (Length: 210)
Name: NF12740_low_58
Description: NF12740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12740_low_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 19 - 200
Target Start/End: Original strand, 2275357 - 2275538
Alignment:
| Q |
19 |
gtccattgttccataaatgtagtcataaagtggcatgaagagtgagtagtttgttctaaactgagtatggtgcaaagagtgaaacctgcagtaataacaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2275357 |
gtccattgttccataaatgtagtcataaagtggcatgaagagtgagtagtttgttctaaactgagtatggtgcaatgagtgaaacctgcagtaataacaa |
2275456 |
T |
 |
| Q |
119 |
gtgaatttatttattaccaactcaaaagggcccacaatctttgaatttgggtgcaagattgaaattcaactcctttgcttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2275457 |
gtgaatttatttattaccaactcaaaagggtccacaatctttgaatttgggtgcaagattgaaattcaactcctttgcttct |
2275538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 69
Target Start/End: Complemental strand, 35355221 - 35355181
Alignment:
| Q |
29 |
ccataaatgtagtcataaagtggcatgaagagtgagtagtt |
69 |
Q |
| |
|
||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
35355221 |
ccataaatgtagtcatacattggcatgaaaagtgagtagtt |
35355181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University