View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12741_low_15 (Length: 240)
Name: NF12741_low_15
Description: NF12741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12741_low_15 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 37223978 - 37224199
Alignment:
| Q |
19 |
gccattgctcataatctattgcaaaacagaataaaaagtgtgacacagacaagaacacgacactgacagttgatacgtcaacacttataataatttgaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37223978 |
gccattgctcataatctattgcaaaacagaataaaaagtgtgacacagacaaggacacgacactgacagttgatacgtcaacacttataataatttgaaa |
37224077 |
T |
 |
| Q |
119 |
aactggtaatatcgaacttagtgacatgtatcagtaacgtgttggtgtcggacgctgatccattttggacactagacaaattttgagtctaaagtgtcaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37224078 |
aactggtaatatcgaacttagtgacatgtatcagtaacgtgttggtgtcgaacgctgatacattttggacactagacaaattttgagtctaaagtgtcag |
37224177 |
T |
 |
| Q |
219 |
tgctacatagttcaaaatcatt |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37224178 |
tgctacatagttcaaaatcatt |
37224199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University