View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12741_low_17 (Length: 227)
Name: NF12741_low_17
Description: NF12741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12741_low_17 |
 |  |
|
| [»] scaffold0317 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 5e-46; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 24 - 132
Target Start/End: Complemental strand, 21156908 - 21156799
Alignment:
| Q |
24 |
ggtggtggtgacggtgagatgatatggtgatagatgacgttaatggcgttcagatctgagagcgacgtgctgg-tggtggcggtggtgtgatttgtgtac |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
21156908 |
ggtggtggtgacggtgagatgatatggtgatagatgacgttaatggcgttcagatctgagtgcgaggtgctggatggtggcggtggtgtgatttgtgtac |
21156809 |
T |
 |
| Q |
123 |
tgttaaaagt |
132 |
Q |
| |
|
|||||||||| |
|
|
| T |
21156808 |
tgttaaaagt |
21156799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 164 - 211
Target Start/End: Complemental strand, 21156767 - 21156720
Alignment:
| Q |
164 |
aagtgaaatacttttgctctgattggcattctaagaaaatgtgaaact |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21156767 |
aagtgaaatacttttgctctgattggcattctaagaaaatgtgaaact |
21156720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 23 - 67
Target Start/End: Original strand, 39481161 - 39481205
Alignment:
| Q |
23 |
cggtggtggtgacggtgagatgatatggtgatagatgacgttaat |
67 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39481161 |
cggtggtggtgacggtgagatgagatggtgatagatgacgttaat |
39481205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 24 - 96
Target Start/End: Complemental strand, 4117603 - 4117531
Alignment:
| Q |
24 |
ggtggtggtgacggtgagatgatatggtgatagatgacgttaatggcgttcagatctgagagcgacgtgctgg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
4117603 |
ggtggtggtgacggtgagatgatatggtgatagatgacgttaatggcgttcagatttgagagcgaggtgctgg |
4117531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 160 - 211
Target Start/End: Complemental strand, 4117482 - 4117431
Alignment:
| Q |
160 |
tcgtaagtgaaatacttttgctctgattggcattctaagaaaatgtgaaact |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4117482 |
tcgtaagtgaaatacttttgctctgattggcattctaagaaaatgtgaaact |
4117431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 21 - 85
Target Start/End: Original strand, 47933927 - 47933991
Alignment:
| Q |
21 |
gacggtggtggtgacggtgagatgatatggtgatagatgacgttaatggcgttcagatctgagag |
85 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| ||||| ||||||||||| ||||||||||||||| |
|
|
| T |
47933927 |
gacgatggtggtgacggtgagatgagatggtaatagacgacgttaatggtgttcagatctgagag |
47933991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 26 - 117
Target Start/End: Complemental strand, 30849834 - 30849743
Alignment:
| Q |
26 |
tggtggtgacggtgagatgatatggtgatagatgacgttaatggcgttcagatctgagagcgacgtgctggtggtggcggtggtgtgatttg |
117 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||| |||||||| |||| |||||||||| || || |||| || ||||||||||||||| |
|
|
| T |
30849834 |
tggtggtgacggtgagatgagatggtaatagatgatgttaatggtgttctgatctgagagtgaggttgtggtagtcacggtggtgtgatttg |
30849743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0317 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0317
Description:
Target: scaffold0317; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 19286 - 19233
Alignment:
| Q |
30 |
ggtgacggtgagatgatatggtgatagatgacgttaatggcgttcagatctgag |
83 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
19286 |
ggtgacggtgagatgagatggtgatagatgacgttaatggtgttcagatttgag |
19233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University