View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12741_low_9 (Length: 291)
Name: NF12741_low_9
Description: NF12741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12741_low_9 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 20 - 291
Target Start/End: Original strand, 33789435 - 33789706
Alignment:
| Q |
20 |
tatttcccttccattgtcaaatactaatccacaacaactaacttcataaagcaagtactacgcatagcaacaaatccaaaatgaagccaaccattttatt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33789435 |
tatttcccttccattgtcaaatactaatccacaacaactaacttcataaagcaagtactacgcatagcaacaaatccaaaatgaagccaacaattttatt |
33789534 |
T |
 |
| Q |
120 |
aatcttcttaatgttcttgctctttccctttgcatttggtgatctcaaagttggattttatagctctagctgcccaagagcagagttgattgtacgtcaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33789535 |
aatcttcttaatgttcttgctctttccctttgcatttggtgatctcaaagttggattttatagctctagctgcccaagagcagagttgattgtacgtcaa |
33789634 |
T |
 |
| Q |
220 |
gttgttgagagaagttttaatcaagatagatccatgactgctgccttgctccgaatgcacttccatgattgc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33789635 |
gttgttgagagaagttttaatcaagatagatccatgactgctgccttgctccgtatgcacttccatgattgc |
33789706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University