View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12742_high_20 (Length: 251)
Name: NF12742_high_20
Description: NF12742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12742_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 39418787 - 39418904
Alignment:
| Q |
1 |
tttaggtacattggattctttgtagctttgtgtaaccaagcagcaccccacaacaactcatcctaacaagtcattacaaacccatcagtcaaaagtacta |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39418787 |
tttaggtacattggattctttgtggctttgtgtaaccaagcagcaccccacaacaactcatcctaacaagtcattacaaacccatcagtcaaaagtacta |
39418886 |
T |
 |
| Q |
101 |
taattttgagtatgactc |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
39418887 |
taattttgagtatgactc |
39418904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 164 - 241
Target Start/End: Original strand, 39418950 - 39419027
Alignment:
| Q |
164 |
ctttacctgataaccagagtaatcacagtaaaagggacacacaaagggttttaagacattgctgtaaggtcctctgtg |
241 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39418950 |
ctttacctgataaccagagtaatcccagtaaaagggacacacaaagggttttaagacattgctgtaaggtcctctgtg |
39419027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 44511968 - 44511906
Alignment:
| Q |
1 |
tttaggtacattggattctttgtagctttgtgtaaccaagcagcaccccacaacaactcatcc |
63 |
Q |
| |
|
|||| ||||||| | ||||| || || ||||| | |||||||||||||||||||||||||||| |
|
|
| T |
44511968 |
tttaagtacattaggttcttagtggccttgtgaagccaagcagcaccccacaacaactcatcc |
44511906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University